Application
ChIP
Sample
Mouse Cell lysate - nuclear (Thyrotrope cell line (T-alpha-T-1))
Negative control
Empty region (called Ct2, Forward : TGCATAAATCAAATGCCCATA, Reverse : GCAAAGGTGATTTGCAGAAA), Beta-actin promoter region (Forward : CTTCCTTTGTCCCCTGAGCTT, Reverse : TCCATGGCGAACTATCAAGAC).
Specification
Thyrotrope cell line (T-alpha-T-1)
Detection step
Real-time PCR
Type
Cross-linking (X-ChIP)
Duration of cross-linking step: 30 minute(s) and 0 second(s)
Specification of the cross-linking agent: Paraformaldehyde
Duration of cross-linking step: 30 minute(s) and 0 second(s)
Specification of the cross-linking agent: Paraformaldehyde
Positive control
Thyroid stimulating hormone bêta sub-unit (Tshb) promoter region (Forward : CAGAGTTTCCAGGGAGAGGA, Reverse : CGAATTGCTGCTTTCTTATCTG). PIT1 is known to bind this Tshb promoter region in thyrotrope cells (Yumiko Kashiwabara, et al. 2009).
Other product details
Incubation time
16 hour(s) and 0 minute(s) · Temperature: 4°C
Dilution
1/10
Additional data
Additional Notes
We performed the ChIP as described in Jean-Noel Laverrière, et al. 2016 with minor modifications. Briefly 20 million cells were cross-linked with 1% formaldehyde for 30 minutes at 37°C, and then formaldehyde was quenched by adding glycine (125 mM final). After nuclei extraction and lysis, chromatin was sheared by five round of 25 seconds sonication at 50% setting with a Bioblock scientific Vibra-Cell sonicator. About 100 µg of chromatin along with 10 µl of antibodies per immunoprecipitation were combined. Immunoprecipitation was carried out at 4°C overnight using 25 µl of Dynabeads™ Protein G (Invitrogen, ThermoFisher Scientific). After extensive washings and elution, chromatin cross-linking was reverted and DNA purified using phenol/chloroform extraction and precipitation. For each genomic region, specific enrichment were quantified by real-time PCR using LightCycler 480 Instrument (Roche Diagnostics) and Takyon No ROX SYBR master mix (Eurogentec). Raw q-PCR data were normalized to chromatin inputs and control region.
The reviewer received a reward from Abcam’s Loyalty Program in thanks for submitting this Abreview and for helping the scientific community make better-informed decisions.
Mr. Vincent Pacini
Verified customer
投稿 Mar 26 2019